Your instructor may assign one or more of the following problems. Don’t feel that you must do all the problems; for the homeworks, you are only required to do those that are explicitly assigned via Moodle.
find_genes.py that prompts the
user to enter a genome and displays all genes in the genome. If no
gene is found in the input sequence, the program displays no
gene is found. Below are a couple sample runs: ================================================================== Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT Gene 1: TTT Gene 2: GGGCGT ================================================================== Enter a genome string: TGTGTGTATAT no gene is found ==================================================================
Write a function that assigns the appropriate part of speech (POS)
to each word in a sentence. It should receive a sentence like
“John kicked the dog.”, and return the list of POS tags:
['n', 'v', 'd', 'n'], indicating that John is a noun, kicked is a
verb, the is a determiner and dog is another noun. Include
“unknown” for words that don’t match any known
words. Helpful functions for this include string.split(),
which creates a list of strings corresponding to the words in the
sentence, and string.endswith(subString),
which checks to see if a string ends with a given sub-string.
The sentence could contain different forms of the words. For example, the nouns could include “dog” and “dogs” and the verbs could include “kick”, “kicks”, “kicked”. Thus, your system should stem each work, that is, remove known suffixes in order to find the unadorned stem of the word. Ignore all punctuation in the input sentence.
Your system should support the following words:
It should also support the following suffixes: -s, -es, -ed.
To make this problem easier to solve, you may make the following assumptions:
Write a function that returns the longest common prefix of two
strings. This function should receive two strings and return a
string. If the strings have no common prefix, the function should
return an empty string. Put this function in a program called find_prefix.py
that prompts the user to enter two strings and then displays their
common prefix.
Submit all appropriate files for grading, including code files, screen captures, supplemental files (e.g., image files), and text files. We will grade this exercise according to the following criteria: