Your instructor may assign one or more of the following problems. Don’t feel that you must do all the problems; for the homeworks, you are only required to do those that are explicitly assigned via Moodle.

1. Mutating a DNA sequence: Write a program called DNA_mutation.py that prompts the user for a string, and a pattern that is present in both the forward and reverse directions of the string. Your program should locate the leftmost occurrence of the pattern, and the next subsequent occurrence of the inverted pattern. The output should be a mutated string where the substring between the pattern and inverted pattern identified is reversed. A few examples follow:

   		
   ===================================================================
   Enter a sequence of characters:	cgattgaacattaagtccaatt
   Enter the pattern: tgaa
   Mutated sequence: cgattgaattacaagtccaatt
   ===================================================================
   Enter a sequence of characters:	hiPattAbCttaPbye
   Enter the pattern:	Patt
   Mutated sequence:	hiPattCbAttaPbye
   ===================================================================
   Enter a sequence of characters:	123456ablewasIereIsawelba654654321
   Enter the pattern:	456
   Mutated sequence:	123456ablewasIereIsawelba654654321
   ===================================================================
   

   Hints:
   • To reverse the string original in Python you can use: reverse = original[::-1]
   • You will probably find the string method find helpful (and you are allowed to use it!)
   • Your code does not need to work if the pattern is not present in the given string.
2. 

   Write a turtle graphics program called triangle.py that reads three sets of x-y coordinates from the user, represents them as three tuples where each tuple represents a point (as you did in the lab exercise).

   With this data structure in place, do the following.

   • Draw the triangle specified by the three points.
   • Draw a dropped perpendicular line from the third point.
   • Computes and print the perimeter and area of the triangle in the upper left of canvas.

   As an example, see the two sample runs on the right. Note that the set of points is printed as a list of tuples, as specified above.

   To simplify the problem, your program may assume that the first two points are on the x axis. Be sure to test various examples that satisfy this criterion.

3. Write a program called shuffler.py to thoroughly shuffle a list of values, by repeatedly 1) removing a value from a random place in the list and then 2) inserting that value back into the list at a random location.

   Have your code first create a list containing 26 strings: 'a', 'b', 'c', etc. Your code does not have to do this programmatically. You should just simply type the list in by hand. E.g., letters = ['a', 'b', typetheresthere...].

   Ask the user how many times to shuffle values in the list. Store the result in an integer variable numTimes.

   Next, your code to remove and reinsert the value as many times as the user wants.

   Finally, print out the shuffled list.

   Hints:

   • Put import random at the top of your file, and then use rand_loc = random.randint(0, len(theList) - 1) to get a random index into the list theList.
   • To do some code repeatedly, you can use a for loop, like so:

     for iter in range(numTimes):
         your code here, indented
         4 spaces for each line.
     

     That code will execute the indented lines numTimes times.
   • You may NOT use the function random.shuffle(), which does everything this assignment is asking, in one line.

Checking In

We will grade this assignment according to the following criteria:

• Correctness:
  • 5% - File is named as specified
  • 5% - Submission folder is named homework03
  • 15% - Prompts/results: User is correctly prompted for input and results are displayed
  • 60% - Computation is correct (e.g. the mutated DNA sequence is correctly generated)
• Understandability:
  • 5% - Header Documentation - Document the code’s basic purpose, authors and assignment number.
  • 10% - Code Documentation - Separate the logical blocks of your programs with useful comments and white space.